Help - Splicing Predictor

1. Single Input Entry

Tutorial

Follow these steps to make a first prediction:

1

Prepare the Sequence

A 70-nucleotide exon sequence containing only A, C, G, T characters is required.

2

Enter the Sequence

Go to the Predict page and paste the sequence. Use "Try Example" if no sequence is available.

3

Submit and Wait

Click "Predict PSI" to submit. The model adds flanking sequences, predicts secondary structure, and computes PSI.

4

View Results

Results include PSI value, RNA structure, MFE, and interactive visualizations showing position contributions.

Exon Entry Requirements

Exactly 70 nucleotides — The model was trained on 70nt exons. 10nt flanking sequences are added automatically.
Valid characters only — Only A, C, G, T accepted. RNA sequences (with U) should be converted to DNA (U → T).
No spaces or headers — Enter raw sequence only. No FASTA headers, spaces, line breaks, or numbers.

Valid Example


                            GGTAGTACGCCAATTCGCCGGTGCCGCGAGCCAGAGGCTACCAAAACTTGACAAGCCTACATATACTACT

Accepted File Upload Formats

For batch predictions, files can be uploaded in these formats:

FASTA (.fasta, .fa)

>Sequence_1
GGTAGTACGCCAATTCGCCGGTGCCGCGAGCCAGAGGCTACCAAAACTTGACAAGCCTACATATACTACT
>Sequence_2
CTACCACCTCCCAAGCTTACACACTGTTTGATGAAAGGTCGCCACAACGTTCCCTCACCCCTAGTCTCGC

CSV (.csv)

Must have columns: name and sequence

name,sequence
Sequence_1,GGTAGTACGCCAATTCGCCGGTGCCGCGAGCCAGAGGCTACCAAAACTTGACAAGCCTACATATACTACT
Sequence_2,CTACCACCTCCCAAGCTTACACACTGTTTGATGAAAGGTCGCCACAACGTTCCCTCACCCCTAGTCTCGC

Plain Text (.txt)

One sequence per line (names auto-generated)

2. Mutagenesis Analysis

The mutagenesis feature generates all possible single-point mutations for the input sequence and predicts PSI for each variant.

210 mutations generated — 70 positions x 3 alternate nucleotides per position
Delta PSI calculation — Shows how each mutation affects splicing relative to the reference
Heatmap visualization — Color-coded view of mutation effects across all positions

Try Mutagenesis Analysis

3. Comparing Sequences

Coming Soon

Sequence comparison features are planned for a future release. This will allow side-by-side comparison of multiple sequences and their predicted PSI values.

4. User Data Storage

Access Tokens

Access tokens allow saving and retrieving prediction history without creating an account.

Generated automatically on first use
Stored in the browser's local storage
Use the same token across devices by copying it

Important: Keep the token safe! Clearing browser data or using a new device means the token will be needed to access history.

Account Login

Create an account for more convenient access to prediction history.

Access history from any device
Link existing token to the account
Secure password-based authentication

Tip: Click the "Login" button in the top navigation bar. Enter an email and password - if no account exists, one will be created automatically.

5. History

The History page shows all past predictions.

Search — Find predictions by job title, sequence ID, or sequence content
Filter — Filter by date range or PSI value
Export — Download selected sequences as CSV

Note: Results are stored for 7 days. Download results if needed for longer retention.

6. Understanding Results

Interpreting PSI Values

PSI (Percent Spliced In) indicates the proportion of transcripts that include the exon. Values range from 0 to 1.

PSI Range	Interpretation	Meaning
0.8 - 1.0	High Inclusion	Exon almost always included
0.3 - 0.8	Variable	Alternatively spliced
0.0 - 0.3	High Skipping	Exon usually skipped

Understanding the Force Plot

The force plot shows how each position contributes to the final PSI prediction.

X-axis Position (1-90). Exon spans 11-80, flanking regions at 1-10 and 81-90.

Y-axis Contribution to PSI. Positive = inclusion, negative = skipping.

Colors Green indicates inclusion, red indicates skipping.

Help & Documentation