Help - Splicing Predictor

1. Single Input Entry

Tutorial

Follow these steps to make your first prediction:

1

Prepare Your Sequence

You'll need a 70-nucleotide exon sequence containing only A, C, G, T characters.

2

Enter Your Sequence

Go to the Predict page and paste your sequence. Use "Try Example" if you don't have a sequence.

3

Submit and Wait

Click "Predict PSI" to submit. The model adds flanking sequences, predicts secondary structure, and computes PSI.

4

View Results

Results include PSI value, RNA structure, MFE, and interactive visualizations showing position contributions.

Exon Entry Requirements

Exactly 70 nucleotides

The model was trained on 70nt exons. 10nt flanking sequences are added automatically.

ACGT

Valid Characters Only

Only A, C, G, T accepted. RNA sequences (with U) should be converted to DNA (U → T).

A C G T

No Spaces or Headers

Enter raw sequence only. No FASTA headers, spaces, line breaks, or numbers.

Valid Example


                            GGTAGTACGCCAATTCGCCGGTGCCGCGAGCCAGAGGCTACCAAAACTTGACAAGCCTACATATACTACT

Accepted File Upload Formats

For batch predictions, you can upload files in these formats:

FASTA (.fasta, .fa)

>Sequence_1
GGTAGTACGCCAATTCGCCGGTGCCGCGAGCCAGAGGCTACCAAAACTTGACAAGCCTACATATACTACT
>Sequence_2
CTACCACCTCCCAAGCTTACACACTGTTTGATGAAAGGTCGCCACAACGTTCCCTCACCCCTAGTCTCGC

CSV (.csv)

Must have columns: name and sequence

name,sequence
Sequence_1,GGTAGTACGCCAATTCGCCGGTGCCGCGAGCCAGAGGCTACCAAAACTTGACAAGCCTACATATACTACT
Sequence_2,CTACCACCTCCCAAGCTTACACACTGTTTGATGAAAGGTCGCCACAACGTTCCCTCACCCCTAGTCTCGC

Plain Text (.txt)

One sequence per line (names auto-generated)

2. Mutagenesis Analysis

The mutagenesis feature generates all possible single-point mutations for your sequence and predicts PSI for each variant.

210 Mutations Generated

70 positions x 3 alternate nucleotides per position

Delta PSI Calculation

Shows how each mutation affects splicing relative to the reference

Heatmap Visualization

Color-coded view of mutation effects across all positions

Try Mutagenesis Analysis

3. Comparing Sequences

Coming Soon

Sequence comparison features are planned for a future release. This will allow side-by-side comparison of multiple sequences and their predicted PSI values.

4. User Data Storage

Access Tokens

Access tokens allow you to save and retrieve your prediction history without creating an account.

Generated automatically on first use

Stored in your browser's local storage

Use the same token across devices by copying it

Important

Keep your token safe! If you clear browser data or use a new device, you'll need the token to access your history.

Account Login

Create an account for more convenient access to your prediction history.

Access history from any device

Link existing token to your account

Secure password-based authentication

Tip: Click the "Login" button in the top navigation bar. Enter your email and password - if you don't have an account, one will be created automatically.

5. History

The History page shows all your past predictions.

Search - Find predictions by job title, sequence ID, or sequence content

Filter - Filter by date range or PSI value

Export - Download selected sequences as CSV

Note: Results are stored for 7 days. Download your results if you need them longer.

6. Understanding Results

Interpreting PSI Values

PSI (Percent Spliced In) indicates the proportion of transcripts that include the exon. Values range from 0 to 1.

PSI Range	Interpretation	Meaning
0.8 - 1.0	High Inclusion	Exon almost always included
0.3 - 0.8	Variable	Alternatively spliced
0.0 - 0.3	High Skipping	Exon usually skipped

Understanding the Force Plot

The force plot shows how each position contributes to the final PSI prediction.

X-axis Position (1-90). Exon spans 11-80, flanking regions at 1-10 and 81-90.

Y-axis Contribution to PSI. Positive = inclusion, negative = skipping.

Colors Inclusion Skipping

Help & Documentation